Which of the following are the post-transcriptional events in an eukaryotic cell?
A. Transport of pre-mRNA to the cytoplasm prior to splicing
B. Removal of introns and joining of exons.
C. Addition of methyl group at 5' end of hnRNA.
D. Addition of adenine residues at 3' end of hnRNA.
E. Base pairing of two complementary RNAs.
Choose the correct answer from the options given below:
1. B, C, E only 2. C, D, E only
3. A, B, C only 4. B, C, D only
Subtopic:  Transcription |
 61%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.

Given below are two statements :
Statement I: Transfer RNAs and ribosomal RNA do not interact with mRNA.
Statement II: RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.

In the light of the above statements, choose the most appropriate answer from the options given below:
1. Statement I is correct but Statement II is incorrect
2. Statement I is incorrect but Statement II is correct
3. Both Statement I and Statement II are correct
4. Both Statement I and Statement II are incorrect
Subtopic:  Translation Mechanism | Transcription |
 63%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.

Which factor is important for termination of transcription?
1. \(\rho\) (rho) 2. \(\gamma\) (gamma)
3. \(\alpha\) (alpha) 4. \(\sigma\) (sigma)
Subtopic:  Transcription |
 80%
Level 1: 80%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

Given below are statements regarding RNA polymerase in prokaryotes:
Statement I: In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription.
Statement II: RNA polymerase associates transiently with 'Rho' factor to initiate transcription. 
In the light of the above statements, choose the correct answer from options given below:
1. Statement I is True but Statement II is False 
2. Statement I is False but Statement II is True 
3. Both Statement I and Statement II are True 
4. Both Statement I and Statement II are False  
Subtopic:  Transcription |
 77%
Level 2: 60%+
NEET - 2024
Hints

Given below are two statements:
Statement I: In eukaryotes, there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelle.
Statement II: All the three RNA polymerases in eukaryotic nucleus have different roles.
In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II is correct.
4. Both Statement I and Statement II is incorrect.
Subtopic:  Transcription |
 85%
Level 1: 80%+
NEET - 2024
Hints

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription  of precursor of mRNA
Subtopic:  Transcription |
 82%
Level 1: 80%+
NEET - 2023
Hints

advertisementadvertisement

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Subtopic:  Transcription: I | Transcription:II | Transcription: III | Transcription: IV | Transcription |
 52%
Level 3: 35%-60%
NEET - 2023
Hints

Given below are two statements:
Statement I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription
Statement II: A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator.
In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false
Subtopic:  Transcription |
 89%
Level 1: 80%+
NEET - 2023
Hints

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

1. Transcribes precursor of mRNA

2. Transcribes only snRNAs

3. Transcribes rRNAs (28S, 18S and 5.8S) 

4. Transcribes tRNA, 5s rRNA and snRNA

Subtopic:  Transcription |
 80%
Level 1: 80%+
NEET - 2021
Hints

advertisementadvertisement

Identify the correct statement:

1. The coding strand in a transcription unit is copied to an mRNA.
2. Split gene arrangement is characteristic of prokaryotes.
3. In capping, methylguanosine triphosphate is added to the 3' end of hnRNA.
4. RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria.

Subtopic:  Transcription |
 69%
Level 2: 60%+
NEET - 2021
Hints