Q. No.Which of the following are the post-transcriptional events in an eukaryotic cell?
Choose the correct answer from the options given below:
| A. | Transport of pre-mRNA to the cytoplasm prior to splicing |
| B. | Removal of introns and joining of exons. |
| C. | Addition of methyl group at 5' end of hnRNA. |
| D. | Addition of adenine residues at 3' end of hnRNA. |
| E. | Base pairing of two complementary RNAs. |
| 1. | B, C, E only | 2. | C, D, E only |
| 3. | A, B, C only | 4. | B, C, D only |
Subtopic: Transcription |
63%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Given below are two statements :
In the light of the above statements, choose the most appropriate answer from the options given below:
| Statement I: | Transfer RNAs and ribosomal RNA do not interact with mRNA. |
| Statement II: | RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence. |
In the light of the above statements, choose the most appropriate answer from the options given below:
| 1. | Statement I is correct but Statement II is incorrect |
| 2. | Statement I is incorrect but Statement II is correct |
| 3. | Both Statement I and Statement II are correct |
| 4. | Both Statement I and Statement II are incorrect |
Subtopic: Translation Mechanism | Transcription |
63%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Which factor is important for termination of transcription?
| 1. | \(\rho\) (rho) | 2. | \(\gamma\) (gamma) |
| 3. | \(\alpha\) (alpha) | 4. | \(\sigma\) (sigma) |
Subtopic: Transcription |
79%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Given below are statements regarding RNA polymerase in prokaryotes:
In the light of the above statements, choose the correct answer from options given below:
1. Statement I is True but Statement II is False
2. Statement I is False but Statement II is True
3. Both Statement I and Statement II are True
4. Both Statement I and Statement II are False
| Statement I: | In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. |
| Statement II: | RNA polymerase associates transiently with 'Rho' factor to initiate transcription. |
1. Statement I is True but Statement II is False
2. Statement I is False but Statement II is True
3. Both Statement I and Statement II are True
4. Both Statement I and Statement II are False
Subtopic: Transcription |
77%
Level 2: 60%+
NEET - 2024
Hints
Given below are two statements:
In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II is correct.
4. Both Statement I and Statement II is incorrect.
| Statement I: | In eukaryotes, there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelle. |
| Statement II: | All the three RNA polymerases in eukaryotic nucleus have different roles. |
1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II is correct.
4. Both Statement I and Statement II is incorrect.
Subtopic: Transcription |
85%
Level 1: 80%+
NEET - 2024
Hints
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription of precursor of mRNA
1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription of precursor of mRNA
Subtopic: Transcription |
82%
Level 1: 80%+
NEET - 2023
Hints
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
| 1. | 3' ATCGATCGATCGATCGATCGATCGATCG 5' |
| 2. | 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3' |
| 3. | 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' |
| 4. | 5' ATCGATCGATCGATCGATCGATCGATCG 3' |
Subtopic: Transcription: I | Transcription:II | Transcription: III | Transcription: IV | Transcription |
52%
Level 3: 35%-60%
NEET - 2023
Hints
Given below are two statements:
In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false
| I: | The process of copying genetic information from one strand of the DNA into RNA is termed as transcription |
| II: | A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator. |
1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false
Subtopic: Transcription |
89%
Level 1: 80%+
NEET - 2023
Hints
Identify the correct statement:
| 1. | The coding strand in a transcription unit is copied to an mRNA. |
| 2. | Split gene arrangement is characteristic of prokaryotes. |
| 3. | In capping, methylguanosine triphosphate is added to the 3' end of hnRNA. |
| 4. | RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria. |
Subtopic: Transcription |
68%
Level 2: 60%+
NEET - 2021
Hints
Which of the following RNAs is not required for the synthesis of protein?
1. rRNA
2. siRNA
3. mRNA
4. tRNA
Subtopic: Transcription |
89%
Level 1: 80%+
NEET - 2021
Hints
© 2025 GoodEd Technologies Pvt. Ltd.