Select Chapter Topics:
Q. No.Which chromosome in the human genome has the highest number of genes?
1.
Chromosome 1
2.
Chromosome 10
3.
Chromosome X
4.
Chromosome Y
Subtopic: Human Genome Project |
70%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Match List-I with List-II:
Choose the correct answer from the options given below:
| List-I | List-II | ||
| A. | Alfred Hershey and Martha Chase | I. | Streptococcus pneumoniae |
| B. | Euchromatin | II. | Densely packed and dark- stained |
| C. | Frederick Griffith | III. | Loosely packed and light-stained |
| D. | Heterochromatin | IV. | DNA as genetic material confirmation |
| 1. | A-IV, B-III, C-I, D-II | 2. | A-III, B-II, C-IV, D-I |
| 3. | A-II, B-IV, C-I, D-III | 4. | A-IV, B-II, C-I, D-III |
Subtopic: Miscellaneous |
78%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Which of the following are the post-transcriptional events in an eukaryotic cell?
Choose the correct answer from the options given below:
| A. | Transport of pre-mRNA to the cytoplasm prior to splicing |
| B. | Removal of introns and joining of exons. |
| C. | Addition of methyl group at 5' end of hnRNA. |
| D. | Addition of adenine residues at 3' end of hnRNA. |
| E. | Base pairing of two complementary RNAs. |
| 1. | B, C, E only | 2. | C, D, E only |
| 3. | A, B, C only | 4. | B, C, D only |
Subtopic: Transcription |
61%
Level 2: 60%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Given below are two statements :
| Statement I : | In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. |
| Statement II : | DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. |
| 1. | Statement I is correct but Statement II is incorrect |
| 2. | Statement I is incorrect but Statement II is correct |
| 3. | Both Statement I and Statement II are correct |
| 4. | Both Statement I and Statement II are incorrect |
Subtopic: RNA world |
82%
Level 1: 80%+
NEET - 2025
Please attempt this question first.
Hints
Please attempt this question first.
Identify the correct statements about genetic codons.
A. AUG is initiator codon and codes for Glycine
B. UAA codes for Tyrosine
C. The codons are mostly universal
D. UAG is terminator codon
E. More than one codon code for single amino acid
A. AUG is initiator codon and codes for Glycine
B. UAA codes for Tyrosine
C. The codons are mostly universal
D. UAG is terminator codon
E. More than one codon code for single amino acid
| 1. | C, B, D | 2. | A, D, E |
| 3. | C, D, E | 4. | A, B, C |
Subtopic: Genetic Code |
78%
Level 2: 60%+
NEET - 2024
Sorry!! currently, the explanation for the question is not provided. If you need further help, please email at support@neetprep.com with subject: Explanation Missing for Question Id: 456731
Hints
Sorry!! currently, the explanation for the question is not provided. If you need further help, please email at support@neetprep.com with subject: Explanation Missing for Question Id: 456731
Match List-I with List-II
Choose the correct answer from the options given below:
| List-I | List-II | ||
| 1. | DNA fingerprinting | I. | M. Meselson and F. Stahl |
| 2. | Pneumococcus | II. | A Harshey and M. Chase |
| 3. | E.coli | III. | F. Griffith |
| 4. | Bacteriophage | IV. | Alec Jeffreys |
| 1. | A-IV, B-III, C-II, D-I | 2. | A-IV, B-III, C-I, D-II |
| 3. | A-II, B-III, C-I, D-IV | 4. | A-III, B-II, C-I, D-IV |
Subtopic: Miscellaneous |
76%
Level 2: 60%+
NEET - 2024
Sorry!! currently, the explanation for the question is not provided. If you need further help, please email at support@neetprep.com with subject: Explanation Missing for Question Id: 456688
Hints
Sorry!! currently, the explanation for the question is not provided. If you need further help, please email at support@neetprep.com with subject: Explanation Missing for Question Id: 456688
Match List-I with List-II:
Choose the correct answer from the options given below:
| List-I | List-II | ||
| A. | RNA polymerase III | I. | snRNPs |
| B. | Termination of transcription | II. | Promotor |
| C. | Splicing of Exons | III. | Rho factor |
| D. | TATA box | IV. | SnRNAs, tRNA |
| 1. | A-III, B-II, C-IV, D-I | 2. | A-III, B-IV, C-I, D-II |
| 3. | A-IV, B-III; C-I, D-II | 4. | A-II, B-IV, C-I, D-III |
Subtopic: Transcription:II | Transcription: III |
87%
Level 1: 80%+
NEET - 2024
Hints
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Subtopic: Transcription: I |
55%
Level 3: 35%-60%
NEET - 2024
Hints
Which of the following statement is correct regarding the process replication in E. coli ?
| 1. | The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3' |
| 2. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' as well as the 3' \(\rightarrow\) 5' direction. |
| 3. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' direction. |
| 4. | The DNA dependent DNA polymerase catalyses polymerization in one direction which is 3' \(\rightarrow\) 5'. |
Subtopic: DNA Replication |
55%
Level 3: 35%-60%
NEET - 2024
Hints
With reference to Hershey and Chase experiments, select the correct statements:
Choose the most appropriate answer from the options given below:
| A: | Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. |
| B: | Viruses grown on radioactive sulphur contained radioactive proteins. |
| C: | Viruses grown on radioactive phosphorus contained radioactive protein |
| D: | Viruses grown on radioactive sulphur contained radioactive DNA |
| E: | Viruses grown on radioactive protein contained radioactive DNA |
| 1. | (D) and (E) only | 2. | (A) and (B) only |
| 3. | (A) and (C) only | 4. | (B) and (D) only |
Subtopic: Search for Genetic Material |
84%
Level 1: 80%+
NEET - 2023
Hints
Select Chapter Topics:
© 2026 GoodEd Technologies Pvt. Ltd.