Unequivocal proof that DNA is the genetic material was first proposed by: 
1. Wilkins and Franklin 
2. Frederick Griffith 
3. Alfred Hershey and Martha Chase 
4. Avery, Macleoid and McCarthy 
Subtopic:  Search for Genetic Material |
 77%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

Expressed Sequence Tags (ESTs) refers to: 
1. Certain important expressed genes.
2. All genes that are expressed as RNA.
3. All genes that are expressed as proteins.
4. All genes whether expressed or unexpressed 
Subtopic:  Human Genome Project |
 66%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription  of precursor of mRNA
Subtopic:  Transcription |
 76%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

How many different proteins does the ribosome consist of?
1. 20  2. 80 
3. 60  4. 40 
Subtopic:  Translation |
 51%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is incorrect but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is correct but Statement II is false.
Subtopic:  DNA Packaging |
 70%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

Match List I with List II
List I List II
A. A. Gene 'a' I. \(\beta\)-galactosidase
B. B. Gene 'y' II. Transacetylase
C. C. Gene 'i' III. Permease
D. D. Gene 'z'  IV. Repressor protein

Choose the correct answer from the options given below:
 
Options: A B C D
1. III I IV II
2. II I IV III
3. II III IV I
4. III IV I II
Subtopic:  Gene Regulation: Lac Operon |
 80%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

Which of the following is not a cloning vector?
1.Probe2.BAC
3.YAC4.PBR322
Subtopic:  Human Genome Project | DNA Fingerprinting |
 75%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

Given below are two statements:
 
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.

In the light of the above statements, choose the correct answer from the options given below:
 
1. Statement I is false but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is true but Statement II is false.
Subtopic:  DNA vs RNA as Genetic Material |
 88%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Subtopic:  Transcription: I | Transcription:II | Transcription: III | Transcription: IV | Transcription |
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.

The last chromosome sequenced in Human Genome project was:
1. Chromosome 6 2. Chromosome 1
3. Chromosome 22 4. Chromosome 14
Subtopic:  Human Genome Project |
 73%
From NCERT
NEET - 2023
Please attempt this question first.
Hints
Please attempt this question first.