| A. | Transport of pre-mRNA to the cytoplasm prior to splicing |
| B. | Removal of introns and joining of exons. |
| C. | Addition of methyl group at 5' end of hnRNA. |
| D. | Addition of adenine residues at 3' end of hnRNA. |
| E. | Base pairing of two complementary RNAs. |
| 1. | B, C, E only | 2. | C, D, E only |
| 3. | A, B, C only | 4. | B, C, D only |
| Statement I: | Transfer RNAs and ribosomal RNA do not interact with mRNA. |
| Statement II: | RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence. |
| 1. | Statement I is correct but Statement II is incorrect |
| 2. | Statement I is incorrect but Statement II is correct |
| 3. | Both Statement I and Statement II are correct |
| 4. | Both Statement I and Statement II are incorrect |
| 1. | \(\rho\) (rho) | 2. | \(\gamma\) (gamma) |
| 3. | \(\alpha\) (alpha) | 4. | \(\sigma\) (sigma) |
| Statement I: | In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. |
| Statement II: | RNA polymerase associates transiently with 'Rho' factor to initiate transcription. |
| Statement I: | In eukaryotes, there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelle. |
| Statement II: | All the three RNA polymerases in eukaryotic nucleus have different roles. |
| 1. | 3' ATCGATCGATCGATCGATCGATCGATCG 5' |
| 2. | 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3' |
| 3. | 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' |
| 4. | 5' ATCGATCGATCGATCGATCGATCGATCG 3' |
| I: | The process of copying genetic information from one strand of the DNA into RNA is termed as transcription |
| II: | A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator. |
What is the role of RNA polymerase III in the process of transcription in eukaryotes?
1. Transcribes precursor of mRNA
2. Transcribes only snRNAs
3. Transcribes rRNAs (28S, 18S and 5.8S)
4. Transcribes tRNA, 5s rRNA and snRNA
Identify the correct statement:
| 1. | The coding strand in a transcription unit is copied to an mRNA. |
| 2. | Split gene arrangement is characteristic of prokaryotes. |
| 3. | In capping, methylguanosine triphosphate is added to the 3' end of hnRNA. |
| 4. | RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria. |