Select Chapter Topics:
Q. No.A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:
1. Structural gene, Transposons, Operator gene
2. Inducer, Repressor, Structural gene
3. Promotor, Structural gene, Terminator
4. Repressor, Operator gene, Structural gene
1. Structural gene, Transposons, Operator gene
2. Inducer, Repressor, Structural gene
3. Promotor, Structural gene, Terminator
4. Repressor, Operator gene, Structural gene
Subtopic: Transcription: I |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyThe lactose present in the growth medium of bacteria is transported to the cell by the action of:
1. Acetylase
2. Permease
3. Polymerase
4. Beta-galactosidase
1. Acetylase
2. Permease
3. Polymerase
4. Beta-galactosidase
Subtopic: Gene Regulation: Lac Operon |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyMatch List I with List II:
Choose the correct answer from the options given below:
1. A-III, B-IV, C-I, D-II
2. A-II, B-III, C-IV, D-I
3. A-IV, B-I, C-II, D-III
4. A-III, B-II, C-I, D-IV
| List I | List II | ||
| A. | Frederick Griffith | I. | Genetic code |
| B. | Francois Jacob & Jacque Monod | II. | Semi-conservative mode of DNA replication |
| C. | Har Gobind Khorana | III. | Transformation |
| D. | Meselson Stahl | IV. | Lac operon |
Choose the correct answer from the options given below:
1. A-III, B-IV, C-I, D-II
2. A-II, B-III, C-IV, D-I
3. A-IV, B-I, C-II, D-III
4. A-III, B-II, C-I, D-IV
Subtopic: Search for Genetic Material:I | Genetic Code: I | Gene Regulation: Lac Operon | Search for Genetic Material |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich of the following statement is correct regarding the process replication in E. coli ?
| 1. | The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3' |
| 2. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' as well as the 3' \(\rightarrow\) 5' direction. |
| 3. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' direction. |
| 4. | The DNA dependent DNA polymerase catalyses polymerization in one direction which is 3' \(\rightarrow\) 5'. |
Subtopic: DNA Replication |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Subtopic: Transcription: I |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyMatch List I with List II:
Choose the correct answer from the options given below:
1. A-III, B-II, C-IV, D-I
2. A-III, B-IV, C-I, D-II
3. A-IV, B-III; C-I, D-II
4. A-II, B-IV, C-I, D-III
| List I | List II | ||
| A. | RNA polymerase III | I. | snRNPs |
| B. | Termination of transcription | II. | Promotor |
| C. | Splicing of Exons | III. | Rho factor |
| D. | TATA box | IV. | SnRNAs, tRNA |
Choose the correct answer from the options given below:
1. A-III, B-II, C-IV, D-I
2. A-III, B-IV, C-I, D-II
3. A-IV, B-III; C-I, D-II
4. A-II, B-IV, C-I, D-III
Subtopic: Transcription:II | Transcription: III |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyMatch List-I with List-II
Choose the correct answer from the options given below:
| List-I | List-II | ||
| 1. | DNA fingerprinting | I. | M. Meselson and F. Stahl |
| 2. | Pneumococcus | II. | A Harshey and M. Chase |
| 3. | E.coli | III. | F. Griffith |
| 4. | Bacteriophage | IV. | Alec Jeffreys |
| 1. | A-IV, B-III, C-II, D-I | 2. | A-IV, B-III, C-I, D-II |
| 3. | A-II, B-III, C-I, D-IV | 4. | A-III, B-II, C-I, D-IV |
Subtopic: Search for Genetic Material |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich of the following is not the characteristic feature of genetic code?
| 1. | The codon is triplet |
| 2. | The code is nearly universal |
| 3. | The code has punctuations |
| 4. | Some amino acids are coded by more than one codon, hence the code is degenerate |
Subtopic: Genetic Code |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich of the following technique was used to elucidate the double helix model of DNA?
1. \(\gamma\)-radiation
2. Electromagnetic radiation
3. UV-Vis spectroscopy
4. X-ray diffraction
1. \(\gamma\)-radiation
2. Electromagnetic radiation
3. UV-Vis spectroscopy
4. X-ray diffraction
Subtopic: DNA Double Helix |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich experimental material was used by Taylor and colleagues to prove that DNA in chromosomes replicates semiconservatively?
1. Vicia faba
2. Pisum sativum
3. Solanum tuberosum
4. Oryza sativa
1. Vicia faba
2. Pisum sativum
3. Solanum tuberosum
4. Oryza sativa
Subtopic: DNA Replication |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologySelect Chapter Topics:
© 2024 GoodEd Technologies Pvt. Ltd.