A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:
1. Structural gene, Transposons, Operator gene
2. Inducer, Repressor, Structural gene
3. Promotor, Structural gene, Terminator 
4. Repressor, Operator gene, Structural gene
Subtopic:  Transcription: I |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

The lactose present in the growth medium of bacteria is transported to the cell by the action of:
1. Acetylase
2. Permease
3. Polymerase
4. Beta-galactosidase
Subtopic:  Gene Regulation: Lac Operon |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Match List I with List II:
List I List II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Transformation
D. Meselson Stahl IV. Lac operon

Choose the correct answer from the options given below:
1. A-III, B-IV, C-I, D-II
2. A-II, B-III, C-IV, D-I
3. A-IV, B-I, C-II, D-III
4. A-III, B-II, C-I, D-IV
Subtopic:  Search for Genetic Material:I | Genetic Code: I | Gene Regulation: Lac Operon | Search for Genetic Material |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Which of the following statement is correct regarding the process replication in E. coli
1. The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3'
2. The DNA dependent DNA polymerase catalyses polymerization in  5' \(\rightarrow\) 3'  as well as the 3' \(\rightarrow\) 5' direction.
3. The DNA dependent DNA polymerase catalyses polymerization in  5' \(\rightarrow\) 3' direction.
4. The DNA dependent DNA polymerase catalyses polymerization in one direction which is 3' \(\rightarrow\) 5'.
Subtopic:  DNA Replication |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Subtopic:  Transcription: I |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Match List I with List II: 
List I List II
A. RNA polymerase III  I. snRNPs
B.  Termination of transcription II. Promotor
C. Splicing of Exons  III. Rho factor
D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below: 
1. A-III, B-II, C-IV, D-I
2. A-III, B-IV, C-I, D-II
3. A-IV, B-III; C-I, D-II
4. A-II, B-IV, C-I, D-III
Subtopic:  Transcription:II | Transcription: III |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Match List-I with List-II
List-I List-II
1. DNA fingerprinting I. M. Meselson and F. Stahl
2. Pneumococcus II. A Harshey and M. Chase 
3.  E.coli III.  F. Griffith
4.  Bacteriophage  IV. Alec Jeffreys 
Choose the correct answer from the options given below: 
1. A-IV, B-III, C-II, D-I 2. A-IV, B-III, C-I, D-II
3. A-II, B-III, C-I, D-IV 4. A-III, B-II, C-I, D-IV
Subtopic:  Search for Genetic Material |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Identify the correct statements about genetic codons. 
A. AUG is initiator codon and codes for Glycine 
B. UAA codes for Tyrosine 
C. The codons are mostly universal 
D. UAG is terminator codon
E. More than one codon code for single amino acid
1. C, B, D 2. A, D, E
3. C, D, E 4. A, B, C 
Subtopic:  Genetic Code |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Which of the following is not the characteristic feature of genetic code?
1. The codon is triplet
2. The code is nearly universal
3. The code has punctuations
4. Some amino acids are coded by more than one codon, hence the code is degenerate
Subtopic:  Genetic Code |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology

Which of the following technique was used to elucidate the double helix model of DNA?
1. \(\gamma\)-radiation
2. Electromagnetic radiation
3. UV-Vis spectroscopy
4. X-ray diffraction
Subtopic:  DNA Double Helix |
Please attempt this question first.
Please attempt this question first.
Please attempt this question first.
Launched MCQ Practice Books

Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot

NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology