Q. No.| Statement I: | In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. |
| Statement II: | RNA polymerase associates transiently with 'Rho' factor to initiate transcription. |
1. Statement I is True but Statement II is False
2. Statement I is False but Statement II is True
3. Both Statement I and Statement II are True
4. Both Statement I and Statement II are False
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| Statement I: | In eukaryotes, there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelle. |
| Statement II: | All the three RNA polymerases in eukaryotic nucleus have different roles. |
1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct.
3. Both Statement I and Statement II is correct.
4. Both Statement I and Statement II is incorrect.
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription of precursor of mRNA
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology| I: | The process of copying genetic information from one strand of the DNA into RNA is termed as transcription |
| II: | A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator. |
1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhat is the role of RNA polymerase III in the process of transcription in eukaryotes?
1. Transcribes precursor of mRNA
2. Transcribes only snRNAs
3. Transcribes rRNAs (28S, 18S and 5.8S)
4. Transcribes tRNA, 5s rRNA and snRNA
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyIdentify the correct statement:
| 1. | The coding strand in a transcription unit is copied to an mRNA. |
| 2. | Split gene arrangement is characteristic of prokaryotes. |
| 3. | In capping, methylguanosine triphosphate is added to the 3' end of hnRNA. |
| 4. | RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria. |
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich of the following RNAs is not required for the synthesis of protein?
1. rRNA
2. siRNA
3. mRNA
4. tRNA
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyWhich is the "Only enzyme" that has the "Capability" to catalyze Initiation, Elongation, and Termination in the process of transcription in prokaryotes?
1. DNA Ligase
2. DNase
3. DNA-dependent DNA polymerase
4. DNA-dependent RNA polymerase
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & BiologyName the enzyme that facilitates opening of DNA helix during transcription.
1. DNA helicase
2. DNA polymerase
3. RNA polymerase
4. DNA ligase
Prefer Books for Question Practice? Get NEETprep's Unique MCQ Books with Online Audio/Video/Text Solutions via Telegram Bot
NEET MCQ Books for XIth & XIIth Physics, Chemistry & Biology
© 2024 GoodEd Technologies Pvt. Ltd.